Publication: "Two Methods of Detection for Streptococcus mutans"
Proceedings of The National Conference
On Undergraduate Research (NCUR) 2005
Washington and LeeUniversity
Virginia Military Institute
Lexington, Virginia
April 21-23, 2005
Two Methods of Detection for Streptococcus mutans
Leesa Gabrielsen and Judy Ball
Clinical Laboratory Sciences
WeberStateUniversity
3905 University Circle
Ogden, UT84408-3905.USA
Faculty Advisor:Scott Wright
Abstract
Streptococcus mutans has been shown to be a major causative agent for dental caries.Two methods of detection have been developed to identify S. mutans: one involving polymerase chain reaction (PCR) and another using Dentocult SM Strips.In the first phase of the project, the PCR procedure was validated and optimized in ourlaboratory.For the PCR procedure, two primers specific to S. mutans were used to identify the presence of the bacterium.In the second phase, the Dentocult SM Strips were validated.The Dentocult procedure involved a 48-hour incubation in a selective nutrient broth for detection of S. mutans.In phase three, dental plaque samples from fifty individuals were analyzed using both methods and the results were statistically compared.The Dentocult procedure was used as the standard to determine the sensitivity and specificity for PCR.According to the manufacturer, the sensitivity and specificity for the Dentocult Strips are 98% and 85% respectively.Based on the results of this experiment, the sensitivity and specificity for PCR were determined to be 75% and 74% respectively.Although the PCR process was shown to be a quicker method of detection, the Dentocult proved to be more accurate in detecting S. mutans.
Introduction
Streptococcus mutans is a Gram positive organism that is a member of the Streptococcus viridans group.This bacterium is a predominant organism of oral flora in many individuals.Because of its ability to convert sugars and carbohydrates into lactic acid, it is a major cause of tooth decay and dental caries.The presence, or even absence, can be a strong predictor of high or low susceptibility to dental caries1,3,5,6,7,8.Assessment of bacterial infection can give the dentist information to aid in decisions regarding therapy for successful control of dental caries.Since the human mouth contains a large variety of oral flora, standard microbiological plating mediatend to be very time consuming and non-specific for the detection of S. mutans.Two other tests have recently been developed for rapid and specific identification of the bacterium, polymerase chain reaction (PCR) and Dentocult SM Strips5.
Polymerase chain reaction has greatly expanded the abilities of molecular biology by providing a quick, easy, and specific method for generating copies of any fragment of DNA.It involves a repeating three-step process using primers to amplify a specific DNA sequence3.The presence of S. mutans in dental plaque samples can be detected with PCR in 24 hours using specific primers for the organism6.
The Dentocult SM Strips were manufactured in Espoo, Finland by Orion Diagnostica, and were first introduced in 2002.The kit was designed so that the detection of S. mutans in plaque can be carried out in a dental office.Plaque samples are obtained from the patient by scraping the teeth and inoculatinga plastic strip that is treated to simulate a tooth surface.The strip is then incubated for 48 hours in a selective nutrient broth and examined for growth of S. mutans5 (see Figure 1).
Figure 1 Growth of S. mutans on Dentocult from class 0 to class 3
Objective
The first phase of the project was to validate the PCR procedure for S. mutans.Using published procedures, the sample collection, DNA extraction, and PCR condition was optimized and validated6 in our laboratory.In the second phase,the Dentocult SM Strips were validated using the procedures suggested by the manufacturer5.Phase three of the projectwas to obtain fifty participant plaque samples and test for the presence of S. mutans.The project was designed to statistically analyze and compare the specificity and sensitivity of both methods, and determine which method is most accurate.
Methods and Materials
phase 1: PCRoptimization and validation
Optimization and validation of the PCR project required the use of two S. mutans specific primers (GTFB-F: ACTACACTTTCGGGTGGCTTGG and GTFB-R: CAGTATAAGCGCCAGTTTCATC) 6 which were purchased from BioChem (Idaho Technology Inc.,Salt Lake City, Utah).The control strain of S. mutans was obtained from ATCC(American Tissue Culture Collection) #35668.This strain was used as the DNA template for the PCR validation and was taken from a pure culture grownon a sheep blood agar (SBA) plate for 24 hours at 37oC.Also, colonies taken from five different participantsamples that showed positive on the Dentocult were tested on three separate PCR runs.As negative PCR controls, DNA was extracted from the following organism to insure that there was no cross-reactivity in the PCR reaction: Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermitis, Staphylococcus saprophyticus, and Escherichia coli.
DNA extraction
In order to extract the DNA, one colony of S. mutans from an SBA plate was added to 200µl of lysis solution (10mM Tris-HCl buffer, 1mM EDTA, and 1% Triton X-100, pH 8.0), vortexed briefly, and placed in a 95°C water bath for 10 minutes.The sample was then centrifuged at 12,000 x g for 5 minutes6.The supernatant was decanted and stored at -20oC.
Section 1.01PCR amplification
The protocol for the PCR procedure uses two primers, GTFB-F and GTFB-R.These two primers amplify a 517 base pair DNA fragment on the gtfB sequence of S. mutans.Each PCR reactionconsisted of 10mM Tris-HCl buffer (pH 8.3), 1.5mM MgCl2, 50mMKCl, 200µM each of dATP, dTTP, dGTP, and dCTP, 1µM primers (GTFB-F and GTFB-R), 1 U TaqDNA polymerase, and 2µl of supernatant from the DNA extraction.The PCRconditions were as follows: denaturation at 95°C for 30 seconds, followed by annealing at 59ºC for 30 seconds, and extension at 72ºC for one minute.The amplification was repeated for 30 cycles using aTechne PCR machine.The amplified products were electrophoresed on 1.0% agarose gel, stained with ethidium bromide, photographed on a UV light box6,and examined for the presence of the 517 bp DNA fragment (see Figure 2).
Figure 2 Example of PCR amplification of the gtfB sequence.Lanes:1, S. mutans, 2-6, participant’s samples; 7, 100 bp size marker; 8-12, participant’s samples; 13; water (no DNA).
phase 2: Dentocult SM Strips validation
The same strain of S. mutans used in the PCR validation was used for the Dentocult SM Strips validation. .The kit contains Dentocult SM round-tipped strips for saliva collection (not used in this study), Dentocult SM square-tipped strips for plaque collection, culture vials containing a selective sucrose nutrient broth, bacitracin discs, and parafilm pellets for saliva production (not used in this study).The selective nutrient broth, along with the bacitracin disc which is added after the broth is inoculated5, are both inhibitory to other streptococcal flora, allowing for enhanced growth of S. mutans2.The Dentocult strips that are normally used to scrape the plaque from the patient’s teeth were inoculated with a colony of S. mutans.The kit was tested repeatedlyover a three-week period using bacterial colonies of S. mutans grown on and SBA plate for 24 hours at 37°C.
Procedure
A bacitracin disc was placed in the selective nutrient broth vial 15 minutes prior to the sample collection.After shaking the vial to evenly distribute the bacitracin, the inoculated strip was placed into the broth.The vial was then placed in an air incubator at 35º-37°C.After 48 hours, the strip was examined for the presence of S. mutans.Any dark-blue to light-blue colonies on the rough surface of the strip indicated the presence of the bacterium5.
phase 3: samplecollection and method comparison
Prior to donating plaque samples, each participant was asked to fill out a questionnaire concerning recent use of antibiotics, food intake, and their history of dental caries.Fifty college students from the Department of Dental Hygiene and the Department of Clinical Laboratory Sciences were asked to scrape 4-5 of their teeth using two toothpicks.One plaque sample was used to inoculate 1.0 ml of Shadler’s brothby swirling the toothpick until the plaque came off, after whichthe tube was incubated at 37°C for 24 hours.The other plaque sample was used to inoculatethe Dentocult SM Strip.The inoculated Dentocult SM strip was thenplaced in the selective nutrient vial and incubated at 37°C for 48 hours.
The DNA for the PCR samples were extracted and amplified using the procedure described above.Data collected was statistically analyzed using the Predictive Value Theory.The Predictive Value Theory is used to calculate the sensitivity and specificity of a test, which helps to determine the reference intervals or normal ranges.The theory uses four terms to classify results:True positives (TP), false positives (FP), true negatives (TN), and false negatives (FN).In this study, true positives are those participants that have S. mutans and tested positive on the Dentocult.The false positives are those participants that did not have the bacterium, but tested positive on the Dentocult.The true negatives are those participants that did not have S. mutans and tested negative on the Dentocult.Finally, the false negatives are those participants that have the bacterium, but tested negative on the Dentocult.By placing each participants result into one of these four categories, the sensitivity and specificity was calculated for the PCR procedure as shown in equation (1) and equation (2).
TP
% Sensitivity=----------- x 100%(1)
TP + FN
TN
% Specificity=----------- x 100%(2)
TN + FP
Results
The PCR project was originally designed to use extracted DNA directly fromsaliva and plaque samples6.However, during the validation process, we found that the detection of S. mutans from saliva and plaque samples was inconsistent when compared to the Dentocult results.At this time, a dilution experiment was preformed to determine the minimum amount of S. mutans that could be detected by the PCR amplification.Using colonies of S. mutans from a culture plate, 10 fold serial dilutions were made, using a nephlometer, ranging from 1x108 – 1x101CFU/ml.DNA was extracted from 1 ml of the dilutions and amplified.Concentrations less than 1x 106 yielded a faint 517 bp PCR band or no band at all.Concentrations above 1 x 106 produced a moderate to high intensity band at 517 bp.Based on these results, the plaque samples to be analyzed by PCR were modified to include a 24 hour incubation at 37oC in Shadler’s broth.
Considering the results of the dilution series for PCR detection, it was determined that a reading of ≤ Class 2 (as outlined by the manufacturer, see Table 1) on the Dentocult would yield a negative PCR result.From this data, the Predictive Value Theory was used to determine the specificity and sensitivity of PCR for detection of S. mutans, using Dentocult SM strips as the standard.PCR results showed 21 positive (weak to strong band at 517 bp) participants and 29 negative participants (see Figure 2).Dentocult readings were reported according to the grading classes (Table 1), ranging from 0 to 3, in 0.5 increments.Class 0 correlates with little to no growth on the Dentocult strip, (as seen in the far left tube in Figure 1) while Class 3 showed heavy growth on the strip (as seen in the far right tube in Figure 1).The number of individuals in each class is shown in Table 2.It was determined that there were 12 true positives, nine false positives, 25 true negatives, and four false negatives for the PCR procedure.The specificity of PCR was calculated to be 74%, meaning that this process can accurately classify 74% of participants that are positive for S. mutans.26% of the positive participants will be false negatives. The sensitivity is 75%, meaning that it will correctly classify 75% of true negative participants.25% of negative participants will be classified as false positives.
Table 1 Dentocult SM Strips grading class5
Class 0
<1x105 CFU/ml
Class 1
<1x105 CFU/ml
Class 2
1x105 – 1x106 CFU/ml
Class 3
>1x106 CFU/ml
Table 2 frequencyof the presence of S. mutans on the Dentocult
Discussion
Although the PCR process usually has the advantage of being a rapid procedure, overnight incubation leading to an increased amount of DNA was necessary for this particular procedure. Saliva samples were initially used in this study, however, a positive PCR amplification was never obtained, even from participants having positive Dentocult results for S. mutans.It was therefore decided to use plaque scrapings as the specimen source.It has been reported that PCR techniques are error-prone when applied to clinical samples such as saliva because they may contain PCR inhibitors6, 8.This may have been a factor in testing saliva and plaque samples without the incubation process, as these inhibitors may have directly affected the PCR amplification.
Dentocult SM Strips is a product that has been validated and is currently being marketed in the United States and Europe.In our study, we chose to use it as the reference standard from which to test the dependability of the PCR procedure for these particular primers (GTFB-F and GTFB-R) in detecting S. mutans.Because the PCR procedure used in this studyrequires a high concentration of S. mutans in order to detect the bacterium, the results did not correlate well with the Dentocult SM Strips.This may be due to the presence of PCR inhibitors in plaque samples, which do not affect the Dentocult samples.Other explanations for the poor correlation could include a low sensitivity of the PCR primers themselves to S. mutans, or possibly the individual PCR conditions used for amplification.During phase 1 of this study, which involved optimization of the PCR in our lab, a MgCl2 gradient was conducted, and a concentration of 1.5mM was found to give the best results6.Optimization of other PCR conditions was not done, and warrants further analysis, such as adjustment of annealing temperature or times, primers, KCl, or dNTP concentrations.
The DNA extraction procedure used in this study could also be the source of the low correlation of the PCR results to the Dentocult results.The lysis procedure is relatively quick and lacks significant purification steps as compared to other more extensive procedures.Further studies could include the use of commercial extraction kits such as one produced by Qiagen (QUIamp DNA Extraction Kit).Such kits involve binding the DNA to a gel matrix and a number of washes that yield a purified DNA template for PCR.
A comparison was done using the questionnaire that participants filled out concerning antibiotic use, food intake, and history of cavities.The correlation for the Dentocult and PCR was somewhat random; while there was correlation with some participants others rendered unpredictable results.Dentocult states that the use of antibiotics within the last two months or intake of food within the last two hours may affect the results5, but this study showed no correlation possibly due to low sample numbers.However, the questionnaire did not specify whether the antibiotic taken was for Gram positive or Gram negative organisms.There was little correlation between the presence of S. mutans and the number of dental caries, possibly due to oral hygiene,or false answers on the questionnaire.While the answers to these questions may affect the presence of S. mutans, the two methods of detection should have still correlated one with another.
In conclusion, the PCR procedures used in this study for the detection of S. mutans were not as specific or as sensitive compared to the Dentocult results.More research needs to be conducted in our lab exploring DNA extraction and PCR conditions in order to increase the sensitivity of PCR in detecting S. mutans.
Acknowledgments
The authors wish to express their appreciation to the Phyllis Crosby Gardner Fellowship and the Weber State University Undergraduate Research Committeefor the funding of the project.We would also like to thank the WSU Clinical Laboratory Sciences Microbiology Professor, Scott Wright.This project has received approval from theIRB (Institutional Review Board of Weber State University) for the use of human subjects in this study.
References
1.Fields, Helen.“Beyond drillings and fillings.”U.S. News & World Report 135 (2003): 48.20 Sept. 2004.
2.Gold, Olga G., et al.“A selective medium for Streptococcus mutans.”Archives of Oral Biology 18 (1973): 1357-1364.
3.Mahon, Connie R. and George Manuselis. Textbook of Diagnostic Microbiology.Philadelphia: W.B. Saunders Company, 2000.
4.Mass, Diana and Galen Robert.“The Predictive Value Theory Redefines Quality Assurance.”Am J Med Tech 47 (1981): 965-970.
5.Orion Diagnostica.“Dentocult SM Strip Mutans.”Package Insert.
6.T. Oho, et al.“Simple and rapid detection of Streptococcus mutans and Streptococcus sobrinus in human saliva by polymerase chain reaction.”Oral Microbiology and Immunology 15 (2000): 258-262.
8.Rupf S, et al.“Comparison of different techniques of quantitative PCR for determination of Streptococcus mutans counts in saliva samples.”Oral Microbiology and Immunology 18 (2003): 50-53.